Collections and Alignments¶
For loading collections of unaligned or aligned sequences see Loading nucleotide, protein sequences.
Basic Collection objects¶
Constructing a SequenceCollection or Alignment object from strings¶
>>> from cogent import LoadSeqs, DNA
>>> dna = {'seq1': 'ATGACC',
... 'seq2': 'ATCGCC'}
>>> seqs = LoadSeqs(data=dna, moltype=DNA)
>>> print type(seqs)
<class 'cogent.core.alignment.Alignment'>
>>> seqs = LoadSeqs(data=dna, moltype=DNA, aligned=False)
>>> print type(seqs)
<class 'cogent.core.alignment.SequenceCollection'>
Converting a SequenceCollection to FASTA format¶
>>> from cogent import LoadSeqs
>>> seq = LoadSeqs('data/test.paml', aligned=False)
>>> fasta_data = seq.toFasta()
>>> print fasta_data
>DogFaced
GCAAGGAGCCAGCAGAACAGATGGGTTGAAACTAAGGAAACATGTAATGATAGGCAGACT
>HowlerMon
GCAAGGAGCCAACATAACAGATGGGCTGAAAGTGAGGAAACATGTAATGATAGGCAGACT
>Human
GCAAGGAGCCAACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACT
>Mouse
GCAGTGAGCCAGCAGAGCAGATGGGCTGCAAGTAAAGGAACATGTAACGACAGGCAGGTT
>NineBande
GCAAGGCGCCAACAGAGCAGATGGGCTGAAAGTAAGGAAACATGTAATGATAGGCAGACT
Adding new sequences to an existing collection or alignment¶
New sequences can be either appended or inserted using the addSeqs method. More than one sequence can be added at the same time. Note that addSeqs does not modify the existing collection/alignment, it creates new one.
Appending the sequences¶
addSeqs without additional parameters will append the sequences to the end of the collection/alignment.
>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs(data= [('seq1', 'ATGAA------'),
... ('seq2', 'ATG-AGTGATG'),
... ('seq3', 'AT--AG-GATG')], moltype=DNA)
>>> print aln
>seq1
ATGAA------
>seq2
ATG-AGTGATG
>seq3
AT--AG-GATG
>>> new_seqs = LoadSeqs(data= [('seq0', 'ATG-AGT-AGG'),
... ('seq4', 'ATGCC------')], moltype=DNA)
>>> new_aln = aln.addSeqs(new_seqs)
>>> print new_aln
>seq1
ATGAA------
>seq2
ATG-AGTGATG
>seq3
AT--AG-GATG
>seq0
ATG-AGT-AGG
>seq4
ATGCC------
Note
The order is not preserved if you use toFasta method, which sorts sequences by name.
Inserting the sequences¶
Sequences can be inserted into an alignment at the specified position using either the before_name or after_name arguments.
>>> new_aln = aln.addSeqs(new_seqs, before_name='seq2')
>>> print new_aln
>seq1
ATGAA------
>seq0
ATG-AGT-AGG
>seq4
ATGCC------
>seq2
ATG-AGTGATG
>seq3
AT--AG-GATG
>>> new_aln = aln.addSeqs(new_seqs, after_name='seq2')
>>> print new_aln
>seq1
ATGAA------
>seq2
ATG-AGTGATG
>seq0
ATG-AGT-AGG
>seq4
ATGCC------
>seq3
AT--AG-GATG
Inserting sequence(s) based on their alignment to a reference sequence¶
Already aligned sequences can be added to an existing Alignment object and aligned at the same time using the addFromReferenceAln method. The alignment is performed based on their alignment to a reference sequence (which must be present in both alignments). The method assumes the first sequence in ref_aln.Names[0] is the reference.
>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs(data= [('seq1', 'ATGAA------'),
... ('seq2', 'ATG-AGTGATG'),
... ('seq3', 'AT--AG-GATG')], moltype=DNA)
>>> ref_aln = LoadSeqs(data= [('seq3', 'ATAGGATG'),
... ('seq0', 'ATG-AGCG'),
... ('seq4', 'ATGCTGGG')], moltype=DNA)
>>> new_aln = aln.addFromReferenceAln(ref_aln)
>>> print new_aln
>seq1
ATGAA------
>seq2
ATG-AGTGATG
>seq3
AT--AG-GATG
>seq0
AT--G--AGCG
>seq4
AT--GC-TGGG
addFromReferenceAln has the same arguments as addSeqs so before_name and after_name can be used to insert the new sequences at the desired position.
Note
This method does not work with the DenseAlignment class.
Removing all columns with gaps in a named sequence¶
>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs(data= [('seq1', 'ATGAA---TG-'),
... ('seq2', 'ATG-AGTGATG'),
... ('seq3', 'AT--AG-GATG')], moltype=DNA)
>>> new_aln = aln.getDegappedRelativeTo('seq1')
>>> print new_aln
>seq1
ATGAATG
>seq2
ATG-AAT
>seq3
AT--AAT
The elements of a collection or alignment¶
Accessing individual sequences from a collection or alignment by name¶
Using the getSeq method allows for extracting an unaligned sequence from a collection or alignment by name.
>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs(data= [('seq1', 'ATGAA------'),
... ('seq2', 'ATG-AGTGATG'),
... ('seq3', 'AT--AG-GATG')], moltype=DNA)
>>> seq = aln.getSeq('seq1')
>>> seq.Name
'seq1'
>>> type(seq)
<class 'cogent.core.sequence.DnaSequence'>
>>> seq.isGapped()
False
Alternatively, if you want to extract the aligned (i.e., gapped) sequence from an alignment, you can use getGappedSeq.
>>> seq = aln.getGappedSeq('seq1')
>>> seq.isGapped()
True
>>> print seq
ATGAA------
To see the names of the sequences in a sequence collection, you can use either the Names attribute or getSeqNames method.
>>> aln.Names
['seq1', 'seq2', 'seq3']
>>> aln.getSeqNames()
['seq1', 'seq2', 'seq3']
Slice the sequences from an alignment like a list¶
The usual approach is to access a SequenceCollection or Alignment object as a dictionary, obtaining the individual sequences using the titles as “keys” (above). However, one can also iterate through the collection like a list.
>>> from cogent import LoadSeqs, DNA
>>> fn = 'data/long_testseqs.fasta'
>>> seqs = LoadSeqs(fn, moltype=DNA, aligned=False)
>>> my_seq = seqs.Seqs[0]
>>> my_seq[:24]
DnaSequence(TGTGGCA... 24)
>>> str(my_seq[:24])
'TGTGGCACAAATACTCATGCCAGC'
>>> type(my_seq)
<class 'cogent.core.sequence.DnaSequence'>
>>> aln = LoadSeqs(fn, moltype=DNA, aligned=True)
>>> aln.Seqs[0][:24]
[0:24]/2532 of DnaSequence(TGTGGCA... 2532)
>>> print aln.Seqs[0][:24]
TGTGGCACAAATACTCATGCCAGC
Getting a subset of sequences from the alignment¶
>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs('data/test.paml', moltype=DNA)
>>> aln.Names
['NineBande', 'Mouse', 'Human', 'HowlerMon', 'DogFaced']
>>> new = aln.takeSeqs(['Human', 'HowlerMon'])
>>> new.Names
['Human', 'HowlerMon']
Note the subset contain references to the original sequences, not copies.
>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs('data/test.paml', moltype=DNA)
>>> seq = aln.getSeq('Human')
>>> new = aln.takeSeqs(['Human', 'HowlerMon'])
>>> id(new.getSeq('Human')) == id(aln.getSeq('Human'))
True
Alignments¶
Creating an Alignment object from a SequenceCollection¶
>>> from cogent.core.alignment import Alignment
>>> seq = LoadSeqs('data/test.paml', aligned=False)
>>> aln = Alignment(seq)
>>> fasta_1 = seq.toFasta()
>>> fasta_2 = aln.toFasta()
>>> assert fasta_1 == fasta_2
Handling gaps¶
Remove all gaps from an alignment in FASTA format¶
This necessarily returns a SequenceCollection.
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs("data/primate_cdx2_promoter.fasta")
>>> degapped = aln.degap()
>>> print type(degapped)
<class 'cogent.core.alignment.SequenceCollection'>
Writing sequences to file¶
Both collection and alignment objects have a writeToFile method. The output format is inferred from the filename suffix,
>>> from cogent import LoadSeqs, DNA
>>> dna = {'seq1': 'ATGACC',
... 'seq2': 'ATCGCC'}
>>> aln = LoadSeqs(data=dna, moltype=DNA)
>>> aln.writeToFile('sample.fasta')
or by the format argument.
>>> aln.writeToFile('sample', format='fasta')
Converting an alignment to FASTA format¶
>>> from cogent.core.alignment import Alignment
>>> seq = LoadSeqs('data/long_testseqs.fasta')
>>> aln = Alignment(seq)
>>> fasta_align = aln.toFasta()
Converting an alignment into Phylip format¶
>>> from cogent.core.alignment import Alignment
>>> seq = LoadSeqs('data/test.paml')
>>> aln = Alignment(seq)
>>> phylip_file, name_dictionary = aln.toPhylip()
Converting an alignment to a list of strings¶
>>> from cogent.core.alignment import Alignment
>>> seq = LoadSeqs('data/test.paml')
>>> aln = Alignment(seq)
>>> string_list = aln.todict().values()
Slicing an alignment¶
By rows (sequences)¶
An Alignment can be sliced
>>> from cogent import LoadSeqs, DNA
>>> fn = 'data/long_testseqs.fasta'
>>> aln = LoadSeqs(fn, moltype=DNA, aligned=True)
>>> print aln[:24]
>Human
TGTGGCACAAATACTCATGCCAGC
>HowlerMon
TGTGGCACAAATACTCATGCCAGC
>Mouse
TGTGGCACAGATGCTCATGCCAGC
>NineBande
TGTGGCACAAATACTCATGCCAAC
>DogFaced
TGTGGCACAAATACTCATGCCAAC
but a SequenceCollection cannot be sliced
>>> from cogent import LoadSeqs, DNA
>>> fn = 'data/long_testseqs.fasta'
>>> seqs = LoadSeqs(fn, moltype=DNA, aligned=False)
>>> print seqs[:24]
Traceback (most recent call last):
TypeError: 'SequenceCollection' object is not subscriptable
Traceback (most recent call last):
TypeError: 'SequenceCollection' object is not subscriptable
Getting a single column from an alignment¶
>>> from cogent.core.alignment import Alignment
>>> seq = LoadSeqs('data/test.paml')
>>> aln = Alignment(seq)
>>> column_four = aln[3]
Getting a region of contiguous columns¶
>>> from cogent.core.alignment import Alignment
>>> aln = LoadSeqs('data/long_testseqs.fasta')
>>> region = aln[50:70]
Iterating over alignment positions¶
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs('data/primate_cdx2_promoter.fasta')
>>> col = aln[113:115].iterPositions()
>>> type(col)
<type 'generator'>
>>> list(col)
[['A', 'A', 'A'], ['T', '-', '-']]
Getting codon 3rd positions from an alignment¶
We’ll do this by specifying the position indices of interest, creating a sequence Feature and using that to extract the positions.
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs(data={'seq1': 'ATGATGATG---',
... 'seq2': 'ATGATGATGATG'})
>>> range(len(aln))[2::3]
[2, 5, 8, 11]
>>> indices = [(i, i+1) for i in range(len(aln))[2::3]]
>>> indices
[(2, 3), (5, 6), (8, 9), (11, 12)]
>>> pos3 = aln.addFeature('pos3', 'pos3', indices)
>>> pos3 = pos3.getSlice()
>>> print pos3
>seq2
GGGG
>seq1
GGG-
Filtering positions¶
Eliminating columns with non-nucleotide characters¶
We sometimes want to eliminate ambiguous or gap data from our alignments. We show how to exclude alignment columns by the characters they contain. In the first instance we do this just for single nucleotide columns, then for trinucleotides (equivalent for handling codons).
>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs(data= [('seq1', 'ATGAAGGTG---'),
... ('seq2', 'ATGAAGGTGATG'),
... ('seq3', 'ATGAAGGNGATG')], moltype=DNA)
We now just define a one-line function that returns True if the passed data contains only nucleotide characters, False otherwise. The function works by converting the aligned column into a set and checking it is equal to, or a subset of, all nucleotides. This function, which works for nucleotides or codons, has the effect of eliminating the (nucleotide/trinucleotide) columns with the ‘N’ and ‘-‘ characters.
>>> just_nucs = lambda x: set(''.join(x)) <= set('ACGT')
We apply to nucleotides,
>>> nucs = aln.filtered(just_nucs)
>>> print nucs
>seq1
ATGAAGGG
>seq2
ATGAAGGG
>seq3
ATGAAGGG
We can also do this in a more longwinded but clearer fashion with a named multi-line function:
>>> def just_nucs(x, allowed = 'ACGT'):
... for char in ''.join(x): # ensure char is a str with length 1
... if not char in allowed:
... return False
... return True
...
>>> nucs = aln.filtered(just_nucs)
>>> nucs
3 x 8 dna alignment: seq1[ATGAAGGG], seq2[ATGAAGGG], seq3[ATGAAGGG]
>>> print nucs
>seq1
ATGAAGGG
>seq2
ATGAAGGG
>seq3
ATGAAGGG
Applying the same filter to trinucleotides (specified by setting motif_length=3).
>>> trinucs = aln.filtered(just_nucs, motif_length=3)
>>> print trinucs
>seq1
ATGAAG
>seq2
ATGAAG
>seq3
ATGAAG
Getting all variable positions from an alignment¶
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs('data/long_testseqs.fasta')
>>> just_variable_aln = aln.filtered(lambda x: len(set(x)) > 1)
>>> print just_variable_aln[:10]
>Human
AAGCAAAACT
>HowlerMon
AAGCAAGACT
>Mouse
GGGCCCAGCT
>NineBande
AAATAAAACT
>DogFaced
AAACAAAATA
Getting all constant positions from an alignment¶
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs('data/long_testseqs.fasta')
>>> just_constant_aln = aln.filtered(lambda x: len(set(x)) == 1)
>>> print just_constant_aln[:10]
>Human
TGTGGCACAA
>HowlerMon
TGTGGCACAA
>Mouse
TGTGGCACAA
>NineBande
TGTGGCACAA
>DogFaced
TGTGGCACAA
Getting all variable codons from an alignment¶
This is exactly the same as before, with a new keyword argument
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs('data/long_testseqs.fasta')
>>> variable_codons = aln.filtered(lambda x: len(set(x)) > 1,
... motif_length=3)
>>> print just_variable_aln[:9]
>Human
AAGCAAAAC
>HowlerMon
AAGCAAGAC
>Mouse
GGGCCCAGC
>NineBande
AAATAAAAC
>DogFaced
AAACAAAAT
Filtering sequences¶
Extracting sequences by sequence identifier into a new alignment object¶
You can use takeSeqs to extract some sequences by sequence identifier from an alignment to a new alignment object:
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs('data/long_testseqs.fasta')
>>> aln.takeSeqs(['Human','Mouse'])
2 x 2532 text alignment: Human[TGTGGCACAAA...], Mouse[TGTGGCACAGA...]
Alternatively, you can extract only the sequences which are not specified by passing negate=True:
>>> aln.takeSeqs(['Human','Mouse'],negate=True)
3 x 2532 text alignment: NineBande[TGTGGCACAAA...], HowlerMon[TGTGGCACAAA...], DogFaced[TGTGGCACAAA...]
Extracting sequences using an arbitrary function into a new alignment object¶
You can use takeSeqsIf to extract sequences into a new alignment object based on whether an arbitrary function applied to the sequence evaluates to True. For example, to extract sequences which don’t contain any N bases you could do the following:
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs(data= [('seq1', 'ATGAAGGTG---'),
... ('seq2', 'ATGAAGGTGATG'),
... ('seq3', 'ATGAAGGNGATG')], moltype=DNA)
>>> def no_N_chars(s):
... return 'N' not in s
>>> aln.takeSeqsIf(no_N_chars)
2 x 12 dna alignment: seq1[ATGAAGGTG--...], seq2[ATGAAGGTGAT...]
You can additionally get the sequences where the provided function evaluates to False:
>>> aln.takeSeqsIf(no_N_chars,negate=True)
1 x 12 dna alignment: seq3[ATGAAGGNGAT...]
Computing alignment statistics¶
Computing motif probabilities from an alignment¶
The method getMotifProbs of Alignment objects returns the probabilities for all motifs of a given length. For individual nucleotides:
>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs('data/primate_cdx2_promoter.fasta', moltype=DNA)
>>> motif_probs = aln.getMotifProbs()
>>> print motif_probs
{'A': 0.24...
For dinucleotides or longer, we need to pass in an Alphabet with the appropriate word length. Here is an example with trinucleotides:
>>> from cogent import LoadSeqs, DNA
>>> trinuc_alphabet = DNA.Alphabet.getWordAlphabet(3)
>>> aln = LoadSeqs('data/primate_cdx2_promoter.fasta', moltype=DNA)
>>> motif_probs = aln.getMotifProbs(alphabet=trinuc_alphabet)
>>> for m in sorted(motif_probs, key=lambda x: motif_probs[x],
... reverse=True):
... print m, motif_probs[m]
...
CAG 0.0374581939799
CCT 0.0341137123746
CGC 0.0301003344482...
The same holds for other arbitrary alphabets, as long as they match the alignment MolType.
Some calculations in cogent require all non-zero values in the motif probabilities, in which case we use a pseudo-count. We illustrate that here with a simple example where T is missing. Without the pseudo-count, the frequency of T is 0.0, with the pseudo-count defined as 1e-6 then the frequency of T will be slightly less than 1e-6.
>>> aln = LoadSeqs(data=[('a', 'AACAAC'),('b', 'AAGAAG')], moltype=DNA)
>>> motif_probs = aln.getMotifProbs()
>>> assert motif_probs['T'] == 0.0
>>> motif_probs = aln.getMotifProbs(pseudocount=1e-6)
>>> assert 0 < motif_probs['T'] <= 1e-6
It is important to notice that motif probabilities are computed by treating sequences as non-overlapping tuples. Below is a very simple pair of identical sequences where there are clearly 2 ‘AA’ dinucleotides per sequence but only the first one is ‘in-frame’ (frame width = 2).
We then create a dinucleotide Alphabet object and use this to get dinucleotide probabilities. These frequencies are determined by breaking each aligned sequence up into non-overlapping dinucleotides and then doing a count. The expected value for the ‘AA’ dinucleotide in this case will be 2/8 = 0.25.
>>> seqs = [('a', 'AACGTAAG'), ('b', 'AACGTAAG')]
>>> aln = LoadSeqs(data=seqs, moltype=DNA)
>>> dinuc_alphabet = DNA.Alphabet.getWordAlphabet(2)
>>> motif_probs = aln.getMotifProbs(alphabet=dinuc_alphabet)
>>> assert motif_probs['AA'] == 0.25
What about counting the total incidence of dinucleotides including those not in-frame? A naive application of the Python string object’s count method will not work as desired either because it “returns the number of non-overlapping occurrences”.
>>> seqs = [('my_seq', 'AAAGTAAG')]
>>> aln = LoadSeqs(data=seqs, moltype=DNA)
>>> my_seq = aln.getSeq('my_seq')
>>> my_seq.count('AA')
2
>>> 'AAA'.count('AA')
1
>>> 'AAAA'.count('AA')
2
To count all occurrences of a given dinucleotide in a DNA sequence, one could use a standard Python approach such as list comprehension:
>>> from cogent import Sequence, DNA
>>> seq = Sequence(moltype=DNA, seq='AAAGTAAG')
>>> seq
DnaSequence(AAAGTAAG)
>>> di_nucs = [seq[i:i+2] for i in range(len(seq)-1)]
>>> sum([nn == 'AA' for nn in di_nucs])
3
Working with alignment gaps¶
Filtering extracted columns for the gap character¶
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs('data/primate_cdx2_promoter.fasta')
>>> col = aln[113:115].iterPositions()
>>> c1, c2 = list(col)
>>> c1, c2
(['A', 'A', 'A'], ['T', '-', '-'])
>>> filter(lambda x: x == '-', c1)
[]
>>> filter(lambda x: x == '-', c2)
['-', '-']
Calculating the gap fraction¶
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs('data/primate_cdx2_promoter.fasta')
>>> for column in aln[113:150].iterPositions():
... ungapped = filter(lambda x: x == '-', column)
... gap_fraction = len(ungapped) * 1.0 / len(column)
... print gap_fraction
0.0
0.666666666667
0.0
0.0...
Extracting maps of aligned to unaligned positions (i.e., gap maps)¶
It’s often important to know how an alignment position relates to a position in one or more of the sequences in the alignment. The gapMaps method of the individual sequences is useful for this. To get a map of sequence to alignment positions for a specific sequence in your alignment, do the following:
>>> from cogent import LoadSeqs
>>> aln = LoadSeqs(data= [('seq1', 'ATGAAGG-TG--'),
... ('seq2', 'ATG-AGGTGATG'),
... ('seq3', 'ATGAAG--GATG')], moltype=DNA)
>>> seq_to_aln_map = aln.getGappedSeq('seq1').gapMaps()[0]
It’s now possible to look up positions in the seq1, and find out what they map to in the alignment:
>>> seq_to_aln_map[3]
3
>>> seq_to_aln_map[8]
9
This tells us that in position 3 in seq1 corresponds to position 3 in aln, and that position 8 in seq1 corresponds to position 9 in aln.
Notice that we grabbed the first result from the call to gapMaps. This is the sequence position to alignment position map. The second value returned is the alignment position to sequence position map, so if you want to find out what sequence positions the alignment positions correspond to (opposed to what alignment positions the sequence positions correspond to) for a given sequence, you would take the following steps:
>>> aln_to_seq_map = aln.getGappedSeq('seq1').gapMaps()[1]
>>> aln_to_seq_map[3]
3
>>> aln_to_seq_map[8]
7
If an alignment position is a gap, and therefore has no corresponding sequence position, you’ll get a KeyError.
>>> seq_pos = aln_to_seq_map[7]
Traceback (most recent call last):
KeyError: 7
Traceback (most recent call last):
KeyError: 7
Note
The first position in alignments and sequences is always numbered position 0.
Filtering alignments based on gaps¶
Note
An alternate, computationally faster, approach to removing gaps is to use the filtered method as discussed in Filtering positions.
The omitGapRuns method can be applied to remove long stretches of gaps in an alignment. In the following example, we remove sequences that have more than two adjacent gaps anywhere in the aligned sequence.
>>> aln = LoadSeqs(data= [('seq1', 'ATGAA---TG-'),
... ('seq2', 'ATG-AGTGATG'),
... ('seq3', 'AT--AG-GATG')], moltype=DNA)
>>> print aln.omitGapRuns(2).toFasta()
>seq2
ATG-AGTGATG
>seq3
AT--AG-GATG
If instead, we just wanted to remove positions from the alignment which are gaps in more than a certain percentage of the sequences, we could use the omitGapPositions function. For example:
>>> aln = LoadSeqs(data= [('seq1', 'ATGAA---TG-'),
... ('seq2', 'ATG-AGTGATG'),
... ('seq3', 'AT--AG-GATG')], moltype=DNA)
>>> print aln.omitGapPositions(0.40).toFasta()
>seq1
ATGA--TG-
>seq2
ATGAGGATG
>seq3
AT-AGGATG
You’ll notice that the 4th and 7th columns of the alignment have been removed because they contained 66% gaps – more than the allowed 40%.
If you wanted to remove sequences which contain more than a certain percent gap characters, you could use the omitGapSeqs method. This is commonly applied to filter partial sequences from an alignment.
>>> aln = LoadSeqs(data= [('seq1', 'ATGAA------'),
... ('seq2', 'ATG-AGTGATG'),
... ('seq3', 'AT--AG-GATG')], moltype=DNA)
>>> filtered_aln = aln.omitGapSeqs(0.50)
>>> print filtered_aln.toFasta()
>seq2
ATG-AGTGATG
>seq3
AT--AG-GATG
Note that following this call to omitGapSeqs, the 4th column of filtered_aln is 100% gaps. This is generally not desirable, so a call to omitGapSeqs is frequently followed with a call to omitGapPositions with no parameters – this defaults to removing positions which are all gaps:
>>> print filtered_aln.omitGapPositions().toFasta()
>seq2
ATGAGTGATG
>seq3
AT-AG-GATG