|
libStatGen Software 1
|
The purpose of this class is to provide accessors for setting, updating, modifying the CIGAR object. It is a child class of Cigar. More...
#include <CigarRoller.h>


Public Member Functions | |
| CigarRoller () | |
| Default constructor initializes as a CIGAR with no operations. | |
| CigarRoller (const char *cigarString) | |
| Constructor that initializes the object with the specified cigarString. | |
| CigarRoller & | operator+= (CigarRoller &rhs) |
| Add the contents of the specified CigarRoller to this object. | |
| CigarRoller & | operator+= (const CigarOperator &rhs) |
| Append the specified operator to this object. | |
| CigarRoller & | operator= (CigarRoller &rhs) |
| Set this object to be equal to the specified CigarRoller. | |
| void | Add (Operation operation, int count) |
| Append the specified operation with the specified count to this object. | |
| void | Add (char operation, int count) |
| Append the specified operation with the specified count to this object. | |
| void | Add (const char *cigarString) |
| Append the specified cigarString to this object. | |
| void | Add (CigarRoller &rhs) |
| Append the specified Cigar object to this object. | |
| bool | Remove (int index) |
| Remove the operation at the specified index. | |
| bool | IncrementCount (int index, int increment) |
| Increments the count for the operation at the specified index by the specified value, specify a negative value to decrement. | |
| bool | Update (int index, Operation op, int count) |
| Updates the operation at the specified index to be the specified operation and have the specified count. | |
| void | Set (const char *cigarString) |
| Sets this object to the specified cigarString. | |
| void | Set (const uint32_t *cigarBuffer, uint16_t bufferLen) |
| Sets this object to the BAM formatted cigar found at the beginning of the specified buffer which is bufferLen long. | |
| int | getMatchPositionOffset () |
| DEPRECATED - do not use, there are better ways to accomplish that by using read lengths, reference lengths, span of the read, etc. | |
| const char * | getString () |
| Get the string reprentation of the Cigar operations in this object, caller must delete the returned value. | |
| void | clear () |
| Clear this object so that it has no Cigar Operations. | |
Public Member Functions inherited from Cigar | |
| Cigar () | |
| Default constructor initializes as a CIGAR with no operations. | |
| void | getCigarString (String &cigarString) const |
| Set the passed in String to the string reprentation of the Cigar operations in this object. | |
| void | getCigarString (std::string &cigarString) const |
| Set the passed in std::string to the string reprentation of the Cigar operations in this object. | |
| void | getExpandedString (std::string &s) const |
| Sets the specified string to a valid CIGAR string of characters that represent the cigar with no digits (a CIGAR of "3M" would return "MMM"). | |
| const CigarOperator & | operator[] (int i) const |
| Return the Cigar Operation at the specified index (starting at 0). | |
| const CigarOperator & | getOperator (int i) const |
| Return the Cigar Operation at the specified index (starting at 0). | |
| bool | operator== (Cigar &rhs) const |
| Return true if the 2 Cigars are the same (the same operations of the same sizes). | |
| int | size () const |
| Return the number of cigar operations. | |
| void | Dump () const |
| Write this object as a string to cout. | |
| int | getExpectedQueryBaseCount () const |
| Return the length of the read that corresponds to the current CIGAR string. | |
| int | getExpectedReferenceBaseCount () const |
| Return the number of bases in the reference that this CIGAR "spans". | |
| int | getNumBeginClips () const |
| Return the number of clips that are at the beginning of the cigar. | |
| int | getNumEndClips () const |
| Return the number of clips that are at the end of the cigar. | |
| int32_t | getRefOffset (int32_t queryIndex) |
| Return the reference offset associated with the specified query index or INDEX_NA based on this cigar. | |
| int32_t | getQueryIndex (int32_t refOffset) |
| Return the query index associated with the specified reference offset or INDEX_NA based on this cigar. | |
| int32_t | getRefPosition (int32_t queryIndex, int32_t queryStartPos) |
| Return the reference position associated with the specified query index or INDEX_NA based on this cigar and the specified queryStartPos which is the leftmost mapping position of the first matching base in the query. | |
| int32_t | getQueryIndex (int32_t refPosition, int32_t queryStartPos) |
| Return the query index or INDEX_NA associated with the specified reference offset when the query starts at the specified reference position. | |
| int32_t | getExpandedCigarIndexFromQueryIndex (int32_t queryIndex) |
| Returns the index into the expanded cigar for the cigar associated with the specified queryIndex. | |
| int32_t | getExpandedCigarIndexFromRefOffset (int32_t refOffset) |
| Returns the index into the expanded cigar for the cigar associated with the specified reference offset. | |
| int32_t | getExpandedCigarIndexFromRefPos (int32_t refPosition, int32_t queryStartPos) |
| Returns the index into the expanded cigar for the cigar associated with the specified reference position and queryStartPos. | |
| char | getCigarCharOp (int32_t expandedCigarIndex) |
| Return the character code of the cigar operator associated with the specified expanded CIGAR index. | |
| char | getCigarCharOpFromQueryIndex (int32_t queryIndex) |
| Return the character code of the cigar operator associated with the specified queryIndex. | |
| char | getCigarCharOpFromRefOffset (int32_t refOffset) |
| Return the character code of the cigar operator associated with the specified reference offset. | |
| char | getCigarCharOpFromRefPos (int32_t refPosition, int32_t queryStartPos) |
| Return the character code of the cigar operator associated with the specified reference position. | |
| uint32_t | getNumOverlaps (int32_t start, int32_t end, int32_t queryStartPos) |
| Return the number of bases that overlap the reference and the read associated with this cigar that falls within the specified region. | |
| bool | hasIndel () |
| Return whether or not the cigar has indels (insertions or delections) | |
Friends | |
| std::ostream & | operator<< (std::ostream &stream, const CigarRoller &roller) |
| Writes all of the cigar operations contained in this roller to the passed in stream. | |
Additional Inherited Members | |
Public Types inherited from Cigar | |
| enum | Operation { none =0 , match , mismatch , insert , del , skip , softClip , hardClip , pad } |
| Enum for the cigar operations. More... | |
Static Public Member Functions inherited from Cigar | |
| static bool | foundInReference (Operation op) |
| Return true if the specified operation is found in the reference sequence, false if not. | |
| static bool | foundInReference (char op) |
| Return true if the specified operation is found in the reference sequence, false if not. | |
| static bool | foundInReference (const CigarOperator &op) |
| Return true if the specified operation is found in the reference sequence, false if not. | |
| static bool | foundInQuery (Operation op) |
| Return true if the specified operation is found in the query sequence, false if not. | |
| static bool | foundInQuery (char op) |
| Return true if the specified operation is found in the query sequence, false if not. | |
| static bool | foundInQuery (const CigarOperator &op) |
| Return true if the specified operation is found in the query sequence, false if not. | |
| static bool | isClip (Operation op) |
| Return true if the specified operation is a clipping operation, false if not. | |
| static bool | isClip (char op) |
| Return true if the specified operation is a clipping operation, false if not. | |
| static bool | isClip (const CigarOperator &op) |
| Return true if the specified operation is a clipping operation, false if not. | |
| static bool | isMatchOrMismatch (Operation op) |
| Return true if the specified operation is a match/mismatch operation, false if not. | |
| static bool | isMatchOrMismatch (const CigarOperator &op) |
| Return true if the specified operation is a match/mismatch operation, false if not. | |
Static Public Attributes inherited from Cigar | |
| static const int | MAX_OP_VALUE = pad |
| static const int32_t | INDEX_NA = -1 |
| Value associated with an index that is not applicable/does not exist, used for converting between query and reference indexes/offsets when an associated index/offset does not exist. | |
Protected Member Functions inherited from Cigar | |
| void | clearQueryAndReferenceIndexes () |
| void | setQueryAndReferenceIndexes () |
Protected Attributes inherited from Cigar | |
| std::vector< CigarOperator > | cigarOperations |
The purpose of this class is to provide accessors for setting, updating, modifying the CIGAR object. It is a child class of Cigar.
Docs from Sam1.pdf:
Clipped alignment. In Smith-Waterman alignment, a sequence may not be aligned from the first residue to the last one. Subsequences at the ends may be clipped off. We introduce operation ʻSʼ to describe (softly) clipped alignment. Here is an example. Suppose the clipped alignment is: REF: AGCTAGCATCGTGTCGCCCGTCTAGCATACGCATGATCGACTGTCAGCTAGTCAGACTAGTCGATCGATGTG READ: gggGTGTAACC-GACTAGgggg where on the read sequence, bases in uppercase are matches and bases in lowercase are clipped off. The CIGAR for this alignment is: 3S8M1D6M4S.
If the mapping position of the query is not available, RNAME and CIGAR are set as “*”
A CIGAR string is comprised of a series of operation lengths plus the operations. The conventional CIGAR format allows for three types of operations: M for match or mismatch, I for insertion and D for deletion. The extended CIGAR format further allows four more operations, as is shown in the following table, to describe clipping, padding and splicing:
op Description
M Match or mismatch I Insertion to the reference D Deletion from the reference N Skipped region from the reference S Soft clip on the read (clipped sequence present in <seq>) H Hard clip on the read (clipped sequence NOT present in <seq>) P Padding (silent deletion from the padded reference sequence) CigarRoller is an aid to correctly generating the CIGAR strings necessary to represent how a read maps to the reference.
It is called once a particular match candidate is being written out, so it is far less performance sensitive than the Smith Waterman code below.
Definition at line 66 of file CigarRoller.h.
|
inline |
Default constructor initializes as a CIGAR with no operations.
Definition at line 79 of file CigarRoller.h.
|
inline |
Constructor that initializes the object with the specified cigarString.
Definition at line 85 of file CigarRoller.h.
References Set().
| void CigarRoller::Add | ( | char | operation, |
| int | count | ||
| ) |
Append the specified operation with the specified count to this object.
Definition at line 84 of file CigarRoller.cpp.
References Add(), Cigar::del, Cigar::hardClip, Cigar::insert, Cigar::match, Cigar::pad, Cigar::skip, and Cigar::softClip.
|
inline |
Append the specified Cigar object to this object.
Definition at line 109 of file CigarRoller.h.
| void CigarRoller::Add | ( | const char * | cigarString | ) |
Append the specified cigarString to this object.
Definition at line 136 of file CigarRoller.cpp.
References Add().
| void CigarRoller::Add | ( | Operation | operation, |
| int | count | ||
| ) |
Append the specified operation with the specified count to this object.
Definition at line 77 of file CigarRoller.cpp.
Referenced by Add(), Add(), GreedyTupleAligner< QueryType, ReferenceType, ReferenceIndex >::Align(), Set(), Set(), SamFilter::softClip(), CigarHelper::softClipBeginByRefPos(), and CigarHelper::softClipEndByRefPos().
| void CigarRoller::clear | ( | ) |
Clear this object so that it has no Cigar Operations.
Definition at line 325 of file CigarRoller.cpp.
Referenced by GreedyTupleAligner< QueryType, ReferenceType, ReferenceIndex >::Align(), operator=(), Set(), Set(), CigarHelper::softClipBeginByRefPos(), and CigarHelper::softClipEndByRefPos().
| int CigarRoller::getMatchPositionOffset | ( | ) |
DEPRECATED - do not use, there are better ways to accomplish that by using read lengths, reference lengths, span of the read, etc.
Definition at line 244 of file CigarRoller.cpp.
References Cigar::del, and Cigar::insert.
| const char * CigarRoller::getString | ( | ) |
Get the string reprentation of the Cigar operations in this object, caller must delete the returned value.
Definition at line 272 of file CigarRoller.cpp.
| bool CigarRoller::IncrementCount | ( | int | index, |
| int | increment | ||
| ) |
Increments the count for the operation at the specified index by the specified value, specify a negative value to decrement.
Definition at line 171 of file CigarRoller.cpp.
Referenced by SamRecord::shiftIndelsLeft().
| CigarRoller & CigarRoller::operator+= | ( | CigarRoller & | rhs | ) |
Add the contents of the specified CigarRoller to this object.
Definition at line 29 of file CigarRoller.cpp.
| CigarRoller & CigarRoller::operator+= | ( | const CigarOperator & | rhs | ) |
Append the specified operator to this object.
Definition at line 43 of file CigarRoller.cpp.
| CigarRoller & CigarRoller::operator= | ( | CigarRoller & | rhs | ) |
Set this object to be equal to the specified CigarRoller.
Definition at line 66 of file CigarRoller.cpp.
References clear().
| bool CigarRoller::Remove | ( | int | index | ) |
Remove the operation at the specified index.
Definition at line 156 of file CigarRoller.cpp.
Referenced by SamRecord::shiftIndelsLeft(), and CigarHelper::softClipEndByRefPos().
| void CigarRoller::Set | ( | const char * | cigarString | ) |
Sets this object to the specified cigarString.
Definition at line 204 of file CigarRoller.cpp.
References Add(), and clear().
Referenced by CigarRoller(), CigarHelper::softClipBeginByRefPos(), and CigarHelper::softClipEndByRefPos().
| void CigarRoller::Set | ( | const uint32_t * | cigarBuffer, |
| uint16_t | bufferLen | ||
| ) |
Sets this object to the BAM formatted cigar found at the beginning of the specified buffer which is bufferLen long.
Definition at line 211 of file CigarRoller.cpp.
| bool CigarRoller::Update | ( | int | index, |
| Operation | op, | ||
| int | count | ||
| ) |
Updates the operation at the specified index to be the specified operation and have the specified count.
Definition at line 187 of file CigarRoller.cpp.
Referenced by SamRecord::shiftIndelsLeft().
|
friend |
Writes all of the cigar operations contained in this roller to the passed in stream.
Definition at line 167 of file CigarRoller.h.